Part:BBa_K1796202:Design

According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below:

crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2)

tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc

To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below:

sgRNA: ca<aaacgggtcttcgagaagacgt>tttagagcta (part of repeat2) gaaa (a linker between crRNA and tracrRNA) tagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption)

To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012 The target oligos are designed by 2013 iGEM team Freiburg. Oligo number: 1 was found at position 29 Oligo1: AAACTGCGTTTCACCCCTGCCGATTCGAGTGTTTGT Oligo2: TAAAACAAACACTCGAATCGGCAGGGGTGAAACGCA